Silencing of C5a receptor gene with siRNA for protection from Gram-negative bacterial lipopolysaccharide-induced vascular permeability
Introduction
The endothelium plays an important role in maintaining normal vascular function. In addition to maintaining a non-thrombogenic surface, secreting anticoagulation factors, responding to and participating in inflammatory signaling and regulating vascular tone, the endothelium also acts as an active barrier between the blood and the underlying tissue. Vascular endothelial dysfunction caused by injury or inflammatory signals has been shown to lead to numerous pathological conditions. Dysfunctional endothelium leads to decreased barrier function or increased permeability. Increased endothelial permeability is characteristic of many diseases and pathological conditions, including atherosclerosis, asthma, tumor growth, edema, and sepsis (van Nieuw Amerongen and van Hinsbergh, 2002, van Hinsbergh, 1997).
Microvascular injury occurring during acute inflammation often results in increased vascular permeability and microvascular haemorrhage. The acute inflammatory response is carefully regulated by the endogenous gene expression of both pro-inflammatory and anti-inflammatory mediators (Lentsch and Ward, 2000). Besides neutrophil-mediated endothelial cytotoxicity (Varani et al., 1992, Fujita et al., 1991), pro-inflammatory cytokines (TNF-α and IL-1) have been shown to induce endothelial injury in the presence of neutrophils, in part due to endothelial cell-enhanced expression of adhesion molecules, appearance in plasma of chemokines, and increased permeability of endothelial monolayers (Rollins, 1997, Meyrick et al., 1991). C5a also is pro-inflammatory mediator. Activation of the complement pathway results in the release of the anaphylatoxin C5a and formation of the membrane attack complex, which induce chemokines and mediate neutrophils activation and infiltration, leading to cell injury, apoptosis, and necrosis (De Vries et al., 2003). C5a induces its inflammatory functions by interacting with C5aR that belongs to the rhodopsin family of seven-transmembrane G protein-coupled receptors (Gerard and Gerard, 1991, Amatruda et al., 1993, Siciliano et al., 1990). C5a has been shown to induce P-selectin expression and secretion of von Willebrand factor (Foreman et al., 1994) and to increase tissue factor activity in vascular endothelial cells (Ikeda et al., 1997). C5aR expression on mouse dermal microvascular endothelial cells and on the microvascular endothelium of lung can be up-regulated, suggesting that C5a in the co-presence of additional agonists may mediate pro-inflammatory effects of endothelial cells (Laudes et al., 2002). C5a can lead to nonspecific, chemotactic “desensitization,” thereby causing broad dysfunction as well as paralysis of MAPK pathways (Riedemann et al., 2004). C5a/C5aR signaling has been implicated in the pathogenesis of many inflammatory and immunological diseases. C5aR on endothelial cells may contribute in various ways to the upregulation of inflammatory processes observed following complement activation (Schraufstatter et al., 2002).
Interventions aimed at blocking C5a/C5aR signaling represent promising targets for therapeutic treatment in the inflammatory disorders. Systemic application of an expressed siRNA can specifically inhibit C5aR gene expression in vivo (Sun et al., 2006). Administration of C5aR-specific siRNA is capable of reducing C5aR and preventing inflammation (Zheng et al., 2008). Recently, we demonstrate that blockade of C5aR with the anti-C5aR antibody markedly decreased microvascular permeability in ischemic myocardial area and leukocyte adherence to coronary artery endothelium (Zhang et al., 2007a).
In the present study, we demonstrate the role of C5aR in vascular endothelial injury and plasma leaking. We demonstrated that an expressed DNA vector-based small interfering RNA (siRNA) can specifically inhibit C5aR-mediated vascular endothelial cell injury in vitro and plasma leakage in vivo indicating an essential role of C5aR in vascular endothelial barrier in pathogenic situation.
Section snippets
C5aR-siRNA design
Two target sequences of C5aR gene were selected. The oligonucleotides containing sequences specific for C5aR were synthesized and annealed.
C5aR #1:
5′-GATCCCGTTTAGAGTGAGCAGAGGCAACTTCAAGAGAGTTGCCTCTGCTCACTCTAAATTTTTTCCAA A-3′
5′-AGCTTTTGGAAAAAATTTAGAGTGAGCAGAGGCAACTCTCTTGAAGTTGCCTCTGCTCACTCTAAACGG-3′;
C5aR #2:
5′-GATCCCGTCAGAAACCAGATGGCGTTTGTTCAAGAGACAAACGCCATCTGGTTTCTGATTTTTTCCAA A-3′
5′-AGCTTTTGGAAAAAATCAGAAACCAGATGGCGTTTGTCTCTTGAACAAACGCCATCTGGTT TCTGACG G-3′)
A C5aR-siRNA expression vector, which
Silencing C5aR in vitro using siRNA
To assess C5aR mRNA expression, primers for mC5aR were designed (as described above), and RT-PCR was performed using total RNA isolated from transfected MDMEC with C5aR-siRNA, as indicated (Fig. 1). For all conditions, equivalent loading for the different templates was verified using primers to GAPDH (Fig. 1A). When levels of C5aR protein from the same samples were detected by Western blot, there were decreases of C5aR protein in siRNA-treated group (Fig. 1B). Cells transfected with EV or SV
Discussion
Complement activation is associated with many pathological states and organ injury. Blockade of C5aR with an anti-C5aR antibody markedly decreases microvascular permeability and leukocyte adherence to endothelium (Zhang et al., 2007a). Efficient gene silencing of C5aR can be achieved using siRNA, and furthermore, results in the inhibition of complement activation and prevention of renal ischemia/reperfusion injury (Zheng et al., 2008). In this study, we have demonstrated that silencing the C5aR
Conflict of interest
None.
Acknowledgements
This work was supported by grants from Chutian Xuezhe Plan of Hubei in China and Hubei University Foundation, NSFC 30811130467 and 30972769/C080802, and the Scientific Research Foundation for the Returned Overseas Chinese Scholars, State Education Ministry in China to Dong-xu Liu.
References (48)
- et al.
C5a-induced gene expression in human umbilical vein endothelial cells
Am. J. Pathol.
(2004) - et al.
Specific interactions of chemoattractant factor receptors with G-proteins
J. Biol. Chem.
(1993) - et al.
Protective effect of a new C5a receptor antagonist against ischemia-reperfusion injury in the rat small intestine
J. Surg. Res.
(2002) - et al.
A small molecule C5a receptor antagonist protects kidneys from ischemia/reperfusion injury in rats
Kidney Int.
(2003) - et al.
Vascular cell adhesion molecule-1 mediates lymphocyte adherence to cytokine-activated cultured human endothelial cells
Blood
(1990) - et al.
A new simple method for isolation of microvascular endothelial cells avoiding both chemical and mechanical injuries
Microvasc. Res.
(1995) - et al.
Involvement of adhesion molecules (CD11a-ICAM-1) in vascular endothelial cell injury elicited by PMA-stimulated neutrophils
Biochim. Biophys. Acta
(1991) - et al.
Complement and Toll-like receptors: key regulators of adaptive immune responses
Mol. Immunol.
(2006) - et al.
C5a negatively regulates Toll-like receptor 4-induced immune responses
Immunity
(2005) - et al.
C1 inhibitor prevents Gram-negative bacterial lipopolysaccharide-induced vascular permeability
Blood
(2005)
Heterogeneity of vascular endothelial cells: differences in susceptibility to neutrophil-mediated injury
Microvasc. Res.
Direct expression cloning of vascular cell adhesion molecule 1, a cytokine-induced endothelial protein that binds to lymphocytes
Cell
Regulation by C5a of neutrophil activation during sepsis
Immunity
Chemokines. Blood
Interaction between the C5a receptor and Gi in both the membrane-bound and detergent-solubilized states
J. Biol. Chem.
Targets for pharmacological intervention of endothelial hyperpermeability and barrier function
Vasc. Pharmacol.
IkappaB kinases: key regulators of the NF-kappaB pathway
Trends Biochem. Sci.
C5aR-mediated myocardial ischemia/reperfusion injury
Biochem. Biophys. Res. Commun.
Regulation of Toll-like receptor-mediated inflammatory response by complement in vivo
Blood
Gene silencing of complement C5a receptor using siRNA for preventing ischemia/reperfusion injury
Am. J. Pathol.
Endotoxin-neutralizing protein protects against endotoxin-induced endothelial barrier dysfunction
Infect. Immun.
Bacterial lipopolysaccharide disrupts endothelial monolayer integrity and survival signaling events through caspase cleavage of adherens junction proteins
J. Biol. Chem.
Cytoskeletal alterations in lipopolysaccharide-induced bovine vascular endothelial cell injury and its prevention by sodium arsenate
Clin. Diagn. Lab. Immunol.
Nitric oxide decreases cytokine-induced endothelial activation. Nitric oxide selectively reduces endothelial expression of adhesion molecules and proinflammatory cytokines
J. Clin. Invest.
Cited by (14)
CD14 inhibition improves survival and attenuates thrombo-inflammation and cardiopulmonary dysfunction in a baboon model of Escherichia coli sepsis
2021, Journal of Thrombosis and HaemostasisThe complement cascade in kidney disease: From sideline to center stage
2013, American Journal of Kidney DiseasesCitation Excerpt :These chemicals promote vasodilation and enhance vascular permeability, facilitating the accumulation of immune cells and inflammatory mediators at the site of tissue injury.3,16 TNF-α and interleukin 1b increase adhesion molecule expression on both leukocytes and endothelial cells, thus promoting leukocyte extravasation.17,18 Leukocytes migrate along a chemical gradient of the anaphylatoxins C3a, C4a, and C5a.2
Complement C5a: Impact on the field of veterinary medicine
2012, Veterinary JournalCitation Excerpt :This complex network elicits a range of tightly controlled inflammatory and cytolytic responses to eradicate pathogens and repair damaged tissue (Rutkowski et al., 2010). Complement proteins act to increase vascular permeability (Liu et al., 2010) and are also chemotactic for inflammatory cells such as monocytes and neutrophils (Damerau et al., 1978; Ricklin et al., 2010), thus promoting the infiltration of these cells into infected and damaged tissue. The presence of pathogens leads to generation of potent inflammatory mediators (anaphylatoxins), opsonization whereby pathogens entering the body are coated by complement components which mark them for destruction by phagocytic cells (Rus et al., 2005) and, finally, targeted lysis of the pathogen through the assembly of membrane-penetrating pores known as the membrane attack complex (MAC) (Walport, 2001).
Cross-talk between the complement and the kinin system in vascular permeability
2011, Immunology LettersCitation Excerpt :A typical example is the infection caused by Aeromonas sobria which cleaves C5 through a serine protease with the release of C5a which induce histamine-mediated vascular leakage [24]. More recently, the potential role of C5aR in endotoxin-induced plasma leakage was documented in a mouse model following the observation that the administration of C5aR–siRNA was effective in preventing endothelial injury and vascular leakage [25]. Activation of ECs is also induced by the late C components from C5 to C9 involved in the assembly of the terminal C complex (TCC).
Advances in the effect of inhibiting complement activation in the treatment of sepsis-associated coagulopathy
2023, Chinese Critical Care MedicineEnolase-specific cross antibodies induce neutrophilic inflammation in the intestine
2021, Journal of Leukocyte Biology