Mechanisms of allergy and clinical immunologyInnate IL-13–producing nuocytes arise during allergic lung inflammation and contribute to airways hyperreactivity
Section snippets
Mice
Il13 was targeted in murine embryonic stem cells by using a recombineering strategy.17 A 5.9-kb genomic DNA fragment spanning exons 1 to 4 was amplified by means of PCR with primers ASEQ3819 (NotI site) and ASEQ3820 (SpeI site) and cloned into the plasmid pl2XR. The fluorescent tandem (td)Tomato cassette was recombineered at the start codon of Il13. The screening probe was amplified by means of PCR from murine genomic DNA using primers ASEQ3058 AGTCACGAGCCAGACCATTC and ASEQ3059
Nuocytes arise during allergic lung inflammation
Allergic lung inflammation occurs as a direct consequence of IL-4, IL-5, and IL-13 cytokine release by immune cells, such as TH2 cells, mast cells, basophils, and eosinophils. Mice were sensitized and challenged with OVA by using either a short 12-day model or a longer 25-day model to determine whether nuocytes form part of this infiltrating cell milieu.
In both protocols side scatter–low cells were found to infiltrate the lung after OVA treatment, and of these cells, around 15% to 20% were
Discussion
Nuocytes are important new innate cells that produce IL-5 and IL-13 (and low levels of IL-4) in response to IL-25 and IL-33, factors that can be produced by airways epithelial cells,9, 29 although their triggers remain elusive. Induction of nuocytes has been shown to be necessary for initiating type 2 responses during N brasiliensis infection.13 Significantly, this opens the possibility that nuocytes and other innate populations like them14, 15 represent a new piece to the type 2 puzzle located
References (32)
- et al.
Type 2 immunity reflects orchestrated recruitment of cells committed to IL-4 production
Immunity
(2004) - et al.
IL-25 induces IL-4, IL-5, and IL-13 and Th2-associated pathologies in vivo
Immunity
(2001) - et al.
IL-33, an interleukin-1-like cytokine that signals via the IL-1 receptor-related protein ST2 and induces T helper type 2-associated cytokines
Immunity
(2005) - et al.
Nuocytes and beyond: new insights into helminth expulsion
Trends Parasitol
(2011) - et al.
Regulation of expression of IL-4 alleles: analysis using a chimeric GFP/IL-4 gene
Immunity
(2001) - et al.
A distinct role for interleukin-13 in Th2-cell-mediated immune responses
Curr Biol
(1998) - et al.
Blocking IL-25 prevents airway hyperresponsiveness in allergic asthma
J Allergy Clin Immunol
(2007) - et al.
IL-4 induces characteristic Th2 responses even in the combined absence of IL-5, IL-9, and IL-13
Immunity
(2002) - et al.
How are T(H)2-type immune responses initiated and amplified? Nature reviews
Immunology
(2010) - et al.
Critical role for IL-13 in the development of allergen-induced airway hyperreactivity
J Immunol
(2001)
IL-13 overexpression predisposes to anaphylaxis following antigen sensitization
J Immunol
Pulmonary expression of interleukin-13 causes inflammation, mucus hypersecretion, subepithelial fibrosis, physiologic abnormalities, and eotaxin production
J Clin Invest
Basophils produce IL-4 and accumulate in tissues after infection with a Th2-inducing parasite
J Exp Med
Type 2 immunity is controlled by IL-4/IL-13 expression in hematopoietic non-eosinophil cells of the innate immune system
J Exp Med
Identification of an interleukin (IL)-25-dependent cell population that provides IL-4, IL-5, and IL-13 at the onset of helminth expulsion
J Exp Med
IL-33 is a crucial amplifier of innate rather than acquired immunity
Proc Natl Acad Sci U S A
Cited by (0)
J.L.B. and S.H.W. were supported by a grant from Centocor, and A.N.J.M. was supported by grants from the American Asthma Federation (no. 10-0078) and Asthma UK (no. 07/001).
Disclosure of potential conflict of interest: J. L. Barlow has received research support from Centocor. A. N. J. McKenzie has received research support from Centocor and the American Asthma Foundation. The rest of the authors declare that they have no relevant conflicts of interest.
- ∗
These authors contributed equally to this work.